Antidepressants called selective serotonin reuptake inhibitors (SSRIs) are among the most common drugs prescribed in the United States today and are well known to elicit adverse skin reactions, such as rashes, urticaria, and in particular pruritus, often leading to noncompliance and interruption of otherwise successful therapies.1Warnock J.K. Morris D.W. Adverse cutaneous reactions to antidepressants.Am J Clin Dermatol. 2002; 3: 329-339Crossref PubMed Scopus (51) Google Scholar Recent studies have reported that all SSRIs are agonists of the serotonin receptor 2B (HTR2B), a G protein–coupled receptor that is coupled to Gq/G11 and mediates excitatory neurotransmission, and that HTR2B is required for SSRI actions in the brain.2Peng L. Gu L. Li B. Hertz L. Fluoxetine and all other SSRIs are 5-HT2B agonists—importance for their therapeutic effects.Curr Neuropharmacol. 2014; 12: 365-379Crossref PubMed Scopus (43) Google Scholar It is now well documented that HTR2B is also expressed in peripheral sensory neurons in trigeminal ganglia (TGs) and dorsal root ganglia (DRGs)3Lin S.-Y. Chang W.-J. Lin C.-S. Huang C.-Y. Wang H.-F. Sun W.-H. Serotonin receptor 5-HT2B mediates serotonin-induced mechanical hyperalgesia.J Neurosci. 2011; 31: 1410-1418Crossref PubMed Scopus (57) Google Scholar and that cutaneous administration of α-methyl serotonin (α-Me-5-HT), a reported selective agonist of HTR2B, evokes very intense scratching responses.4Imamachi N. Park G.H.H. Lee H. Anderson D.J.J. Simon M.I.I. Basbaum A.I.I. et al.TRPV1-expressing primary afferents generate behavioral responses to pruritogens via multiple mechanisms.Proc Natl Acad Sci U S A. 2009; 106: 11330-11335Crossref PubMed Scopus (338) Google Scholar However, whether HTR2B in sensory neurons mediates pruritus to SSRIs and through which mechanism remain important open questions. To address the possibility that peripheral HTR2B is involved directly in SSRI-induced pruritus, we first examined whether cutaneous administration of the SSRI sertraline evokes pain and itch in the “cheek model” of itch5Shimada S.G. LaMotte R.H. Behavioral differentiation between itch and pain in mouse.Pain. 2008; 139: 681-687Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar by counting the number of pain-indicative wipes by a forearm and the number of itch-like scratches by a hind paw of a mouse (number of bouts over 30 minutes), respectively. Sertraline elicited itch-like scratching in a dose-dependent manner but not wiping behavior (Fig 1, A and B). Although it has been reported that cutaneous administration of 100 μmol/L sertraline induces itch through serotonin receptor 7 (HTR7), with a concomitant increase in 5-hydroxytryptamine (5-HT) levels in the skin,6Morita T. McClain S.P. Batia L.M. Pellegrino M. Wilson S.R. Kienzler M.A. et al.HTR7 mediates serotonergic acute and chronic itch.Neuron. 2015; 87: 124-138Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar we observed robust scratching behavior only at a higher dose of 1 mmol/L sertraline, and signaling did not require HTR7 (see Fig E1, A, in this article's Online Repository at www.jacionline.org). Notably, mice injected with 1 mmol/L sertraline scratched immediately and intensively for 10 minutes (Fig 1, C) similar to α-Me-5-HT (see Fig E2, A and B, in this article's Online Repository at www.jacionline.org) and independent of the concentration of 5-HT in the skin (Fig 1, D). To test whether sertraline requires HTR2B, we next evaluated the role of HTR2B in SSRI-evoked itch. Scratches induced by common SSRIs, such as sertraline, citalopram, fluoxetine, and 5-HT, were all reduced significantly in mice receiving the potent and specific HTR2B antagonists SB-204741 (see Fig E1, B) or RS-127445 (Fig 1, E, and see Fig E1, C), which also significantly attenuated α-Me-5-HT–induced itch (Fig 1, F). Furthermore, ex vivo saphenous skin nerve preparation showed that action potential firing induced by cutaneous application of α-Me-5-HT was significantly reduced by RS-127445 (see Fig E2, C). Our results make clear that peripheral HTR2B expression is required specifically for itch behaviors evoked by SSRIs, 5-HT, and α-Me-5HT. We next sought to test whether HTR2B in primary sensory neurons is responsible for the SSRI-evoked itch by intrathecally delivering small interfering RNA (siRNA) to silence the expression of HTR2B protein in cervical DRGs (see Fig E3, A and B, in this article's Online Repository at www.jacionline.org). Compared with mice receiving a control siRNA, mice injected with siRNA targeting HTR2B exhibited a significant decrease in sertraline-evoked itch behavior (Fig 1, G), suggesting the requirement of neuronal expression of HTR2B for the induction of itch to SSRIs. Various pruritogens require transient receptor potential channel (TRP) V1–expressing C fibers for the induction of itch, including α-Me-5HT.4Imamachi N. Park G.H.H. Lee H. Anderson D.J.J. Simon M.I.I. Basbaum A.I.I. et al.TRPV1-expressing primary afferents generate behavioral responses to pruritogens via multiple mechanisms.Proc Natl Acad Sci U S A. 2009; 106: 11330-11335Crossref PubMed Scopus (338) Google Scholar Pretreatment with resiniferatoxin, an ultrapotent TRPV1 agonist, resulted in loss of capsaicin sensitivity (see Fig E3, C) and significantly reduced sertraline-evoked scratches (Fig 1, H). Indeed, immunohistochemistry revealed that HTR2B is expressed in murine small- to medium-sized TRPV1+ peptidergic sensory neurons (see Figs E4, A and B, and Fig E5 in this article's Online Repository at www.jacionline.org), which was confirmed by using single-cell RT-PCR analysis of small-sized DRG neurons (see Fig E4, C, and see Table E1 for primer sequences). Mechanistically, most pruritogen receptors are coupled with TRPV1, TRPV4, and TRPA1, which are critical for different forms of itch transmission.7Ross S.E. Pain and itch: insights into the neural circuits of aversive somatosensation in health and disease.Curr Opin Neurobiol. 2011; 21: 880-887Crossref PubMed Scopus (117) Google Scholar In line with our characterization of HTR2B expression, application of α-Me-5-HT induces rapid calcium responses in DRG neurons that also respond to the TRPV1 agonist capsaicin (Fig 2, A and B). Further calcium imaging analysis also indicates that α-Me-5-HT–induced responses are independent from internal stored calcium, dependent on the extracellular calcium concentration, and driven potentially by phospholipase C β3 (see Fig E6 in this article's Online Repository at www.jacionline.org), as previously reported.4Imamachi N. Park G.H.H. Lee H. Anderson D.J.J. Simon M.I.I. Basbaum A.I.I. et al.TRPV1-expressing primary afferents generate behavioral responses to pruritogens via multiple mechanisms.Proc Natl Acad Sci U S A. 2009; 106: 11330-11335Crossref PubMed Scopus (338) Google Scholar However, α-Me-5-HT–evoked calcium responses were not altered in TRPV1 knockout (KO) mice (Fig 2, B), and scratching behavior was not significantly reduced in TRPV1 and TRPA1 KO mice (Fig 2, C, and see Fig E7, A, in this article's Online Repository at www.jacionline.org) or by TRPA1 and TRPV4 inhibitors (see Fig E7, B and C), which is in agreement with previous studies in KO mice.8Liu B. Escalera J. Balakrishna S. Fan L. Caceres A.I. Robinson E. et al.TRPA1 controls inflammation and pruritogen responses in allergic contact dermatitis.FASEB J. 2013; 27: 3549-3563Crossref PubMed Scopus (165) Google Scholar Sertraline-evoked scratching behavior was not significantly reduced in TRPA1 KO mice (see Fig E7, D). Because HTR2 receptors mediate calcium influx through the nonselective calcium-permeable cation channel TRPC4 in thalamocortical neurons,9Munsch T. Freichel M. Flockerzi V. Pape H.-C. Contribution of transient receptor potential channels to the control of GABA release from dendrites.Proc Natl Acad Sci U S A. 2003; 100: 16065-16070Crossref PubMed Scopus (98) Google Scholar we tested whether TRPC4 colocalizes with HTR2B in DRG neurons and mediates the HTR2B agonists α-Me-5-HT and BW-723C86, as well as SSRI scratch behavior. Immunohistochemistry clearly indicates that HTR2B-positive neurons also expressed TRPC4 (see Fig E8, A, in this article's Online Repository at www.jacionline.org). In agreement, calcium imaging indicated complete unresponsiveness of neurons from TRPC4 KO mice (TRPC4 KO) to α-Me-5-HT and BW-723C86 (Fig 2, B, and see Fig E8, B), and patch-clamp recordings showing that α-Me-5-HT–elicited inward current were also abolished by the TRPC4 antagonist ML204 in DRG neurons (see Fig E8, C). Likewise, α-Me-5-HT–elicited neuronal activity in skin nerve preparation is significantly reduced by ML204 (see Fig E8, D). Thus HTR2B activation induces calcium responses and neuronal excitability through phospholipase C β3 and TRPC4. Finally, we sought to test the functional role of TRPC4 in scratching behavior evoked by α-Me-5-HT and antidepressants. Compared with control mice, α-Me-5-HT–and BW-723C86–evoked itch was significantly attenuated in TRPC4 KO mice or mice receiving ML204 (Fig 2, C and D, and see Fig E9 in this article's Online Repository at www.jacionline.org) or mice injected with siRNA targeting Trpc4 but not with siRNA targeting the TRPC4-interacting channels Trpc1 or Trpc5 (Fig 2, E, and see Figs E10 and E11 in this article's Online Repository at www.jacionline.org). In addition, mice receiving ML204 exhibited significantly reduced scratching to the antidepressants sertraline, citalopram, and fluoxetine (Fig 2, F), and sertraline-induced scratching was not observed in TRPC4 KO mice (Fig 2, G). It should be noted that oral sertraline did not induce pruritus in mice (data not shown), and we subcutaneously injected greater concentrations of SSRIs compared with those observed in patients' sera. However, we used concentrations of SSRIs that are commonly used in animal experimentation and consistent with the concentrations of other pruritogens.4Imamachi N. Park G.H.H. Lee H. Anderson D.J.J. Simon M.I.I. Basbaum A.I.I. et al.TRPV1-expressing primary afferents generate behavioral responses to pruritogens via multiple mechanisms.Proc Natl Acad Sci U S A. 2009; 106: 11330-11335Crossref PubMed Scopus (338) Google Scholar, 8Liu B. Escalera J. Balakrishna S. Fan L. Caceres A.I. Robinson E. et al.TRPA1 controls inflammation and pruritogen responses in allergic contact dermatitis.FASEB J. 2013; 27: 3549-3563Crossref PubMed Scopus (165) Google Scholar Furthermore, pruritus in patients can result from particular individual genetic predisposition, overdose, and peripheral accumulation of SSRIs in the skin. Differential targeting of peripheral versus central targets could also explain the paradox that although an estimated 2% to 4% of human patients report adverse skin reactions to SSRIs, SSRIs can also partially alleviate some forms of chronic itch.1Warnock J.K. Morris D.W. Adverse cutaneous reactions to antidepressants.Am J Clin Dermatol. 2002; 3: 329-339Crossref PubMed Scopus (51) Google Scholar It remains to be tested whether HTR2B and TRPC4 are also involved in chronic itch. However, given that HTR2B and TRPC4 are also expressed in human DRG tissues (see Fig E12 in this article's Online Repository at www.jacionline.org), this previously unknown itch signaling pathway (Fig 2, H) might well be also responsible for pruritus in patients taking SSRIs. We thank D. E. Clapham for providing TRPC4 KO mice and D. P. Roberson for his technical assistance, as well as R. H. LaMotte and S. Davidson for critical comments on the manuscript. We purchased sertraline (catalog no. S6319), citalopram hydrobromide (catalog no. C7861), fluoxetine hydrochloride (catalog no. F132), α-Me-5HT (catalog no. M110), ML204 (catalog no. SML0400), resiniferatoxin (catalog no. R8756), capsaicin (catalog no. M2028), RS127445 (catalog no. R2533), SB204741 (catalog no. S0693), thapsigargin (catalog no. T9033), U73343 (catalog no. U6881), SB269970 (S7389), BW 723C86 (B175), and U73122 (catalog no. U6756) from Sigma (St Louis, Mo). 4F 4PP oxalate (catalog no. 0523) and RS102221 (catalog no. 1050) from Tocris (Bristol, United Kingdom) and SB269970 (catalog no. ab120508) from Abcam (Cambridge, United Kingdom). Mouse Htr2b-, Trpc1-, Trpc4-and Trpc5-targeting siRNAs (catalog nos. 15559, 22063, 22066, and 22067) and nontargeting siRNA were purchased from Bioneer (Daejon, Korea). Lipofectamine 2000 (catalog no. 11668027) and Invivofectamine 3.0 (catalog no. IVF3001) from Invitrogen (Carlsbad, Calif) was mixed with siRNA to increase the uptake of siRNA by DRGs.E1Dalby B. Cates S. Harris A. Ohki E.C. Tilkins M.L. Price P.J. et al.Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.Methods. 2004; 33: 95-103Crossref PubMed Scopus (427) Google Scholar All mouse procedures were approved by the Institutional Animal Care and Use Committee of Hanyang University or the University of Cincinnati. Animal experiments were also conducted in accordance with the National Institutes of Health's “Guide for the care and use of laboratory animals.” CD-1, B6129PF2/J, and C57BL/6 mice were purchased from Charles River Laboratories (Wilmington, Mass), Orient Bio (Seongnam, Korea), or the Jackson Laboratory (Bar Harbor, Me). TRPV1 (catalog no. 027390) and TRPA1 (catalog no. 006401) KO mice were purchased from the Jackson Laboratory, and TRPC4 KO animals were previously characterizedE2Riccio A. Li Y. Tsvetkov E. Gapon S. Yao G.L. Smith K.S. et al.Decreased anxiety-like behavior and Gαq/11-dependent responses in the amygdala of mice lacking TRPC4 channels.J Neurosci. 2014; 34: 3653-3667Crossref PubMed Scopus (64) Google Scholar and obtained from David Clapham laboratory. Adult mice (male, 8-10 weeks old) were used for behavioral and biochemical studies. Young mice (4-6 weeks of both sexes) were used for Ca2+ imaging and electrophysiologic studies in TG and DRG neurons. All animals were housed under a 12-hour light/dark cycle with food and water available ad libitum. Sample sizes were estimated based on our previous studies for similar types of behavioral, biochemical, Ca2+ imaging, and electrophysiologic analyses.E3Chen G. Park C.-K. Xie R.-G. Ji R.-R. Intrathecal bone marrow stromal cells inhibit neuropathic pain via TGF-β secretion.J Clin Invest. 2015; 125: 3226-3240Crossref PubMed Scopus (124) Google Scholar, E4Berta T. Park C.K. Xu Z.Z. Xie R.G. Liu T. Lü N. et al.Extracellular caspase-6 drives murine inflammatory pain via microglial TNF-α secretion.J Clin Invest. 2014; 124: 1173-1186Crossref PubMed Scopus (130) Google Scholar, E5Xu Z.-Z. Kim Y.H. Bang S. Zhang Y. Berta T. Wang F. et al.Inhibition of mechanical allodynia in neuropathic pain by TLR5-mediated A-fiber blockade.Nat Med. 2015; 21: 1326-1331Crossref PubMed Scopus (200) Google Scholar Mice were habituated to the testing environment daily for at least 2 days before testing. Room temperature and humidity remained stable for all experiments. Most behavioral tests were produced by using the “cheek model,” which can distinguish itch and pain responses, as previously described.E6Shimada S.G. LaMotte R.H. Behavioral differentiation between itch and pain in mouse.Pain. 2008; 139: 681-687Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar Briefly, mice cheeks were shaved after brief anesthesia with isoflurane at least 2 days before experiments. On the day of the experiment, mice were placed in chambers (15 × 25 × 10 cm) and allowed to habituate for 30 minutes. Then mice were removed from the chambers and given an intradermal injection of various drugs into the cheek (20 μL) or nape (50 μL). Immediately after injection, mice were video recorded, and scratches and/or wipes were quantified subsequently by observers blinded to the treatment of the animals. We also injected drugs in the napes or cheeks of mice and counted the number of bouts for 30 minutes. In this case animals were shaved at the nape or cheek on the day before drug injection. A bout was counted when a mouse lifted its hind paw to scratch the shaved region and returned the paw to the floor. Based on previous reportsE6Shimada S.G. LaMotte R.H. Behavioral differentiation between itch and pain in mouse.Pain. 2008; 139: 681-687Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar, E7Morita T. McClain S.P. Batia L.M. Pellegrino M. Wilson S.R. Kienzler M.A. et al.HTR7 mediates serotonergic acute and chronic itch.Neuron. 2015; 87: 124-138Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar and our preliminary studies, the following drug doses were selected: sertraline (1 mmol/L), fluoxetine (1 mmol/L), citalopram (1 mmol/L), 5-HT (10 μg), α-me-5HT (cheek, 4 μg; nape, 10 μg), histamine (200 μg), chloroquine (100 μg), and BW 723C86 (cheek, 4 μg; nape, 10 μg). To examine the roles of TRPV1-expressing C-fibers in sertraline-induced itch, we destroyed the C-fibers by means of treatment with the potent TRPV1 receptor agonist resiniferatoxin (50 μg/kg administered subcutaneously) starting 7 days before the sertraline injection, as described previously.E8Nassini R. Pedretti P. Moretto N. Fusi C. Carnini C. Facchinetti F. et al.Transient receptor potential ankyrin 1 channel localized to non-neuronal airway cells promotes non-neurogenic inflammation.PLoS One. 2012; 7: e42454Crossref PubMed Scopus (171) Google Scholar Selective siRNA and nontargeting control siRNA were synthesized by Bioneer. siRNA was dissolved in RNase-free water at the concentration of 1.4 μg/μL as stock solution and mixed withLipofectamine 2000 (Invitrogen) or Invivofectamine 3.0 (Invitrogen) 10 minutes before injection to increase cell membrane penetration and reduce degradation.Lipofectamine 2000 or Invivofectamine 3.0 was dissolved in 5% glucose, and 1 μg of siRNA was mixed with 2.62 μL of Lipofectamine 2000 or Invivofectamine 3.0. We intrathecally injected 10 μL of siRNA (3 μg) once a day for 3 days to knockdown gene expression.E9Liu T. Berta T. Xu Z.Z. Park C.K. Zhang L. Lü N. et al.TLR3 deficiency impairs spinal cord synaptic transmission, central sensitization, and pruritus in mice.J Clin Invest. 2012; 122: 2195-2207Crossref PubMed Scopus (127) Google Scholar, E10Cho H. Yang Y.D. Lee J. Lee B. Kim T. Jang Y. et al.The calcium-activated chloride channel anoctamin 1 acts as a heat sensor in nociceptive neurons.Nat Neurosci. 2012; 15: 1015-1021Crossref PubMed Scopus (266) Google Scholar DRGs from all spinal levels of 6- to 8-week-old mice were removed aseptically and incubated with collagenase (5 mg/mL; Roche, Mannheim, Germany)/Dispase II (1 mg/mL; Roche) at 37°C for 40 minutes and then digested with 2.5% trypsin (Invitrogen) for 7 minutes at 37°C, followed by 0.25% trypsin inhibitor (Sigma). Cells were dissociated mechanically with a flame-polished Pasteur pipette in the presence of 0.05% DNAse I (Sigma). DRG cells were plated onto glass coverslips and then plated onto glass coverslips previously coated with a solution of 0.1 mg/mL poly-l-ornithine. DRG cells were grown in a neurobasal defined medium (with 2% B27 supplement; Invitrogen) at 37°C in a 5% CO2 atmosphere. DRG neurons were grown for 18 hours before use.E5Xu Z.-Z. Kim Y.H. Bang S. Zhang Y. Berta T. Wang F. et al.Inhibition of mechanical allodynia in neuropathic pain by TLR5-mediated A-fiber blockade.Nat Med. 2015; 21: 1326-1331Crossref PubMed Scopus (200) Google Scholar We performed Fura-2 AM–based (Molecular Probes, Eugene, Ore) Ca2+ imaging experiments, as previously described.E11Kim Y.H. Park C.-K. Back S.K. Lee C.J. Hwang S.J. Bae Y.C. et al.Membrane-delimited coupling of TRPV1 and mGluR5 on presynaptic terminals of nociceptive neurons.J Neurosci. 2009; 29: 10000-10009Crossref PubMed Scopus (58) Google Scholar Briefly, DRG neurons prepared were loaded with Fura-2 AM (2 μmol/L) and 0.01% Pluronic F-127 (wt/vol; Life Technologies, Grand Island, NY) for 40 minutes at 37°C in Dulbecco modified Eagle medium containing 10% FBS and 1% penicillin-streptomycin. Extracellular solution contained 140 mmol/L NaCl, 5 mmol/L KCl, 10 mmol/L HEPES, 2 mmol/L CaCl2, 1 mmol/L MgCl2, and 10 mmol/L D-(+)-glucose, pH 7.3. Acquired images were displayed as a ratio of 340 to 380 nm. Cells were illuminated with lamp and were excited with Lambda DG-4 (Sutter Instrument, Novato, Calif) and identified as neurons by means of eliciting depolarization with high-potassium solution (50 mmol/L) at the end of each experiment. Intracellular Ca2+ concentrations were measured by using digital video microfluorometry with camera (C11440; Hamamatsu, Shizuoka, Japan) coupled to a microscope (IX70; Olympus, Center Valley, Pa) and a computer with Metafluor software (Universal Imaging, Bedford Hills, NY). All graphs displaying Fura-2 ratios were normalized to the baseline ratio as follows: F340/F380 = (Ratio)/(Ratio t = 0), and all drugs were applied by means of bath perfusion at a flow rate of 3 to 5 mL/min. Whole-cell current-clamp recordings were performed at room temperature to measure currents with HEKA EPC10 (HEKA, Lambrecht/Pfalz, Germany). Patch pipettes were pulled from borosilicate capillaries (Chase Scientific Glass, Rockwood, Calif). When filled with the pipette solution, the resistance of the pipettes was approximately 4 to 6 MΩ. The recording chamber was continuously perfused (2 mL/min). Series resistance was compensated for greater than 80%, and leak subtraction was performed. Pulse v8.30 software (HEKA) was used during experiments and analysis. The internal pipette solution was composed of 140 mmol/L KCl, 1 mmol/L CaCl2, 2 mmol/L MgCl2, 10 mmol/L EGTA, 10 mmol/L D-glucose, and 10 mmol/L HEPES adjusted to pH 7.3 with NaOH (osmolarity, 295-300 mOsm). Extracellular solution contained 140 mmol/L NaCl, 5 mmol/L KCl, 2 mmol/L CaCl2, 1 mmol/L MgCl2, 10 mmol/L HEPES, and 10 mmol/L D-glucose adjusted to pH 7.3 with NaOH (osmolarity, 300-310 mOsm). Voltage-clamp experiments were performed at a holding potential of −60 mV.E12Lee S.H. Moon J.Y. Jung S.J. Kang J.G. Choi S.P. Jang J.H. Eugenol inhibits the GABAA current in trigeminal ganglion neurons.PLoS One. 2015; 10: e0117316PubMed Google Scholar Ex vivo single-fiber recordings were carried out, as previously described.E13Zimmermann K. Hein A. Hager U. Kaczmarek J.S. Turnquist B.P. Clapham D.E. et al.Phenotyping sensory nerve endings in vitro in the mouse.Nat Protoc. 2009; 4: 174-196Crossref PubMed Scopus (126) Google Scholar Briefly, mice were killed with CO2 inhalation, and the hairy skin of the hind paw innervated by saphenous nerve was dissected after attached connective tissue, muscle, or tendon was removed. The organ bath consisted of 2 chambers (perfusion and recording chambers) separated by an acrylic-based wall. The perfusion chamber is continuously superfused with SIF (3.5 mmol/L KCl, 107.8 mmol/L NaCl, 0.69 mmol/L MgSO4·7H2O, 1.53 mmol/L CaCl2·2H2O, 1.67 mmol/L NaH2PO4·2H2O, 26.2 mmol/L NaHCO3, 9.64 mmol/L C6H11NaO7, 7.6 mmol/L sucrose, and 5.55 mmol/L glucose), which was saturated with a mixture of 95% O2 and 5% CO2 and maintained at 31°C ± 1°C. After dissection, the preparation was placed with the epidermal side down. The nerves attached to the skin were drawn to the recording chamber filled with paraffin oil. The nerve was placed on a fixed mirror, the sheath was removed, and nerve filaments were repeatedly teased to allow single-fiber recordings to be made by using 2 gold electrodes, one for recording and the other for reference. Spikes from single C-fibers were recorded extracellularly with a differential amplifier (DP 311; Warner Instruments, Hamden, Conn), transferred to a computer by using a data acquisition system (DAP5200a; Microstar Laboratory, Crystal Lake, Ill) and analyzed offline by using the window discrimination feature of the software (Dapsys 8; Bethel University, http://dapsys.net/).E14Jang J.H. Clark J.D. Li X. Yorek M.S. Usachev Y.M. Brennan T.J. Nociceptive sensitization by complement C5a and C3a in mouse.Pain. 2010; 148: 343-352Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar Single-cell RT-PCR was performed, as previously described.E4Berta T. Park C.K. Xu Z.Z. Xie R.G. Liu T. Lü N. et al.Extracellular caspase-6 drives murine inflammatory pain via microglial TNF-α secretion.J Clin Invest. 2014; 124: 1173-1186Crossref PubMed Scopus (130) Google Scholar Briefly, a DRG neuron of small size (<20 μm) was aspirated into a patch pipette with a tip diameter of about 20 μm, gently put into a reaction tube containing reverse transcription reagents, and incubated for 60 minutes at 50°C and then for 15 minutes at 70°C (Superscript III; Invitrogen). The cDNA product was used in a separate PCR. Sequences of the primers used are presented in Table E1. The first round of PCR was performed in 25 μL of PCR buffer containing 100 nmol/L “outer” primers, 3 μL of RT product, and 22 μL of platinum PCR mixture (2.5 μL of PCR Buffer10×, 0.75 μL of 50 mmol/L MgCl2 solution, 0.5 μL of 10 mmol/L dNTP mix, and 18.25 μL of nuclease-free water; Invitrogen) for 35 cycles. The protocol included an initial 5-minute denaturizing step at 94°C, followed by 35 to 40 cycles of 30 seconds of denaturation at 94°C, 30 seconds of annealing at 57°C, and 1 minute of elongation at 72°C. The reaction was completed with 10 minutes of final elongation. For the second round of amplification, the reaction buffer (20 μL) contained 100 nmol/L “inner” primers, 1 μL of the first-round PCR products, and 18 μL of platinum PCR premix (Bioneer). The reaction procedure for these primers was the same as the first round. A negative control was obtained from pipettes that did not harvest any cell contents but were submerged in the bath solution. The PCR products were displayed on 1.5% agarose gels with SYBR Safe DNA Gel Stain. cDNA was synthesized with SuperScript III reverse transcriptase (Life Technologies). Samples were diluted 2:100 and used as a template for PCR experiments. The following primer pairs were used: mouse Htr2b (forward, 5′-CTGTGAGTGTCTGGTAGGTTTG-3′; reverse, 5′-CTGCTTCATTTCCTCTGCTACT-3′), mouse Trpc4 (forward, 5′-CGACCATGCAGATATAGA ATGGAA-3′; reverse, 5′-TGGTATTGGTGATGTCTTCTCAAG-3′), mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh; forward, 5′-TGAAGGTCGGTGTGAACGAATT-3′; reverse, 5′-GCTTTCTCCATGGTGGTGAAGA-3′), human HTR2B (forward, 5′-GAACGTTTTGGCGATTTCAT-3′; reverse, 5′-AACCATGTTAGGCGTTGAGG-3′), human TRPC4 (forward, 5′-CTCTGGGAAGAATGCTCCTG-3′; reverse, 5′-CAGGGACTGCAGTGTCTCAA-3′), and human GAPDH (forward, 5′-ACCCAGAAGACTGTGGATGG-3′; reverse, 5′-TTCTAGACGGCAGGTCAGGT-3′).E9Liu T. Berta T. Xu Z.Z. Park C.K. Zhang L. Lü N. et al.TLR3 deficiency impairs spinal cord synaptic transmission, central sensitization, and pruritus in mice.J Clin Invest. 2012; 122: 2195-2207Crossref PubMed Scopus (127) Google Scholar Mice were anesthetized terminally with isoflurane and perfused through the ascending aorta with saline, followed by 4% paraformaldehyde. DRGs and TGs were removed and postfixed in the same fixative overnight. Tissue sections were cut in a cryostat (12 μm) and processed for immunofluorescence. Tissue sections were blocked with Blockade solution (Invitrogen) and incubated overnight at 4°C with the following primary antibodies against HTR2B (rabbit, 1:1000; Novus, Littleton, Colo; catalog NBP1-55429), TRPC4 (sheep, 1:1000; Thermo Scientific, Waltham, Mass; catalog OST00025W), IB4 (1:1000; Thermo scientific; catalog I32450), calcitonin gene-related peptide (CGRP; goat, 1:500; Abcam; catalog ab36001), and 4′-6-diamidino-2-phenylindole dihydrochloride (300 nmol/L; Thermo Scientific; catalog D1306). Sections were then incubated for 1 hour at room temperature with Alexa Fluor 594– or Alexa Fluor 488–conjugated secondary antibodies. Immunostained tissues were then examined under an Olympus fluorescence microscope, and images were captured with a high resolution CCD Spot camera (DP80; Olympus) and analyzed with CellSens (Olympus). Cheek skin was homogenized in Ripa lysis buffer (Millipore, Burlington, Mass) containing protease and phosphatase inhibitors. Protein concentrations were measured with Qubit (Invitrogen). 5-HT levels were measured by using the serotonin ELISA kit (catalog no. ADI-900-175; Enzo Life Sciences, Farmingdale, NY). The standard curve was included in the experiment. Protein samples were prepared in the same way as for ELISA analysis. Samples were mixed with Ripa lysis buffer and kept in a cryogenic freezer, samples were homogenized with a tissue homogenizer, and total protein was extracted. Concentration of protein were measured by using the Bradford protein assay (Bio-Rad Laboratories, Hercules, Calif). Twenty micrograms of protein was loaded for each lane and separated by 10% SDS-PAGE gel. Western blotting membranes were blocked with 5% skim milk for 1 hour and incubated for overnight at 4°C with TRPC4 (sheep, 1:500; Thermo scientific; catalog OST00025 W), TRPC1 (mouse, 1:500; Neuromab, Davis, Calif; catalog 73-278), TRPC5 (mouse, 1:500; Neuromab; catalog 73-104), or HTR2B (rabbit, 1:1000; Novus; catalog NBP1-55429). Samples were incubated at rabbit (1:2000; Santa Cruz Biotechnology, Dallas, Tex; sc-2030), sheep (1:2000; Santa Cruz Biotechnology; sc-2473), or mouse (1:2000; Santa Cruz Biotechnology; sc-2005) secondary antibody (1:2000; Santa Cruz Biotechnology; sc-2030) and developed in ECL solution (Pierce, Rockford, Ill). Membranes were scanned by with Chemidoc XRS (Bio-Rad Laboratories), and specific bands were evaluated based on apparent molecular sizes. The ratio of band intensities of protein normalized to GAPDH or actin was calculated with ImageJ software (National Institutes of Health, Bethesda, Md). Values are reported as means ± SEMs. For comparison between 2 groups, the Student t test was used. For single-point comparison between more than 2 groups, 1-way ANOVA followed by the Tukey post hoc test was used. For the time-course comparison between more than 2 groups, 2-way ANOVA for multivariate linear models was used. For ex vivo single-fiber recording, 1-way repeated-measures ANOVA, followed by the SNK post hoc test was used.Fig E2α-Me-5-HT triggers itch and action potential firing through HTR2B. A, Subcutaneous injections of α-Me-5HT into the cheek do not evoke wiping behavior but elicit strong scratching behaviors. B, Time course of scratching behaviors (n = 5 mice/group). C, Example of ex vivo single-fiber recordings in application of α-Me-5HT (200 mmol/L) or α-Me-5HT with RS127445 (800 mmol/L, n = 9 fibers over 3 mice). Error bars indicate means ± SEMs. *P < .05, **P < .01, and ***P < .001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3siRNA reduces HTRB2 in DRGs, and resiniferatoxin (RTX) treatment impairs capsaicin-evoked pain. A and B, Western blotting showing knockdown of HTR2B expression of approximately 40% in DRGs by Htr2b siRNA treatment (3 μg/d for 3 days). C, After pretreatment with RTX (50 μg/kg, single injection), mice are completely insensitive to capsaicin-evoked pain (n = 5 mice/group). Error bars indicate means ± SEMs. *P < .05 and ***P < .001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E4HTRB2 is expressed in small TRPV1+ sensory neurons. A, Immunohistochemistry in mouse TGs and DRGs shows that HTR2B is enriched in small- to medium-sized cells (cross-sectional area in square micrometers, n = 4-5 sections, 791 DRG neurons). Error bars indicate means ± SEMs. Scale bars = 20 μm. B, HTR2B is colocalized with the peptidergic fiber marker CGRP but not with the non-peptidergic fiber marker IB4 in DRG neurons. C, Single-cell RT-PCR showing that all small-sized DRG neurons (diameter, <25 μm) expressing Htr2b also express Trpv1. M, Molecular weight; NC, negative controls from pipettes that did not harvest any cell contents but were submerged in the bath solution. Yellow asterisk indicates HTR2B- positive neurons. Full-length gels are shown in Fig E5.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E5Full-length gels of Fig E4, C. Single-cell RT-PCR analysis in small DRG neurons shows colocalization of HTR2B with TRPV1. Red boxes show representative results for Fig E4, C.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E6α-Me-5HT evoked calcium responses through phospholipase C (PLC). A and B, Ca2+ transients evoked by sequential application of 5 μmol/L α-Me-5HT were blocked by extracellular Ca2+-free conditions (n = 7; Fig E6, A) but not by 1 μmol/L thapsigargin (n = 9; Fig E6, B). C, α-Me-5HT (5 μmol/L)–induced Ca2+ responses were abolished by 2 μmol/L U73122 (n = 14) but not by U73343 (n = 6). Error bars indicate means ± SEMs. ****P < .0001. NS, Not significant.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E7α-Me-5HT and sertraline evoked itch responses independently from TRPA1 and TRPV4. A-C, Scratching behavior evoked by α-Me-5HT (4 μg) is significantly greater compared with that evoked by a vehicle control (3.8 ± 2.154 bouts per 30 minutes) but is not attenuated in TRPA1 KO mice (TRPA−/−) compared with wild-type (WT) mice (n = 5 per group; Fig E7, A) or by the TRPA1 antagonist HC030031 (40 μg, n = 6 mice/group; Fig E7, B) and the TRPV4 antagonist HC067047 (40 μg, n = 6 mice/group; Fig E7, C). D, Similarly, scratching behavior evoked by sertraline (1 mmol/L) is unaffected in TRPA−/− mice compared with WT mice (n = 6 mice/group). Of note, vehicle control induced very limited scratching behavior. Error bars indicate means ± SEMs. *P ≥ .05. NS, Not significant.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E8TRPC4 colocalizes with HTR2B and regulates neuronal activity induced by HTR2B agonists. A, Immunohistochemistry showing that HTR2B colocalizes with TRPC4 in TG. DAPI, 4′-6-Diamidino-2-phenylindole dihydrochloride. B, Calcium responses evoked by HTR2B agonist BW-723C86 (5 μmol/L) in a wild-type (WT) mouse (25/122 neurons). In contrast, no calcium response was observed in a TRPC4 KO mouse (TRPC4−/−, 0/103 neurons). Traces are representative of Fura-2 calcium responses, and the histogram shows the percentage of positive cells to BW-723C86. C, α-Me-5HT (patch, 2 μmol/L)–induced currents were abolished by ML204 (patch, 20 μmol/L). D, Example of ex vivo single-fiber recordings in application of α-Me-5HT (666 μmol/L) or α-Me-5HT with the TRPC4 antagonist ML204 (3.5 mmol/L, n = 14 fibers over 3 mice). Error bars indicate means ± SEMs. **P < .01 and ****P < .0001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E9HTR2B activation promotes scratching behavior through TRPC4. A, Time course of scratching behavior evoked by α-Me-5HT (10 μg) is dose dependently decreased by the TRPC4 antagonist ML204 (n = 5 mice/group). B, Quantification of total bouts per 30 minutes of scratching behavior evoked by α-Me-5HT (10 μg) and its dose-dependent attenuation by ML204 (n = 5 mice/group). C, Scratching behavior evoked by the HTR2B agonist BW-723C86 (4 μg) is significantly decreased in mice coinjected with ML204 (40 μg, n = 6 per group). D, Scratching behavior evoked by BW-723C86 (10 μg) was also abolished in TRPC4 KO mice compared with wild-type (WT) mice (n = 5 mice/group). Error bars indicate means ± SEMs. **P < .01 and ****P < .0001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E10HTR2B activation induces itch through TRPC4 but not TRPC1 and TRPC5. A, Onset of scratching behavior evoked by α-Me-5HT (10 μg) is significantly decreased in mice injected with TRPC4 siRNA (siTRPC4, n = 6-7 mice/group). B-D, Western blotting showing knockdown of TRPC4, TRPC1, and TRPC5 expression of approximately 40% to 60% in DRGs by targeting siRNA treatment (3 μg/d, 3 days, n = 4-5 mice/group). Error bars indicate means ± SEMs. *P < .05, **P < .01, and ***P < .001. Full-length gels are shown in Fig E11.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E11Full-length gels of Figs E3, A, and E10, B-D. Western blot analysis of DRG tissues shows knockdown of HTR2B, TRPC4, TRPC1, and TRPC5. Red boxes show representative results for Figs E3, A, and E10, B-D. N, Control siRNA; S, targeting siRNA.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E12HTR2B and TRPC4 are expressed in human DRG tissues. PCR amplification of Htr2b (A) and Trpc4 (B) transcripts shows expression in mouse and human DRGs. Experimental details and primer sequences are described in the Methods section.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Primer sequences for single-cell RT-PCRTarget gene (product length)Outer primersInner primersGenBank no.HTR2B (483 bp, 174 bp)AATGCTGGATGGGTCTCACATGGTACATGGCAGGGTTGATTGGTACATGGCAGGGTTGATACTGACTTTGTGGCTCGGTANM_008311TRPV1 (273 bp, 203 bp)TGATCATCTTCACCACGGCTGCCTTGCGATGGCTGAAGTACAAAGGCTTGCCCCCCTATAACACCAGCATGAACAGTGACTGTNM_001001445.1GAPDH (367 bp, 313 bp)AGCCTCGTCCCGTAGACAAAATTTTGGCTCCACCCCTTCATGAAGGTCGGTGTGAACGAATTGCTTTCTCCATGGTGGTGAAGAXM_001473623.1 Open table in a new tab
Search from 250 M+ research papersSearch from 250 M+ research papers
Open Access
Apr 1, 2024
Naman Gupta + 12